View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SD37_high_5 (Length: 286)
Name: SD37_high_5
Description: SD37
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SD37_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 8342749 - 8343006
Alignment:
| Q |
18 |
taagttacatctgttcgagtttcagagaaaactttccctcttgaagtactcagatcaagttttctctgatgatttggctttactacaaagaggatatggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342749 |
taagttacatctgttcgagtttcagagaaaactttccctcttgaagtactcagatcaagttttctctgatgatttggctttactacaaagaggatatggg |
8342848 |
T |
 |
| Q |
118 |
agcaaaacgtataatatgtattttgcatttcatcaggttcaaaactctcttgtattttgacaactactatttatttccatatttttgtatattaatatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342849 |
agcaaaacgtataatatgtattttgcatttcatcaggttcaaaactctcttgtattttgacaactactatttatttccatatttttgtatattaatatca |
8342948 |
T |
 |
| Q |
218 |
ggacatggtacacaaggaaaagttcttgaaattgtgtcctgttcttttgtgtagaaca |
275 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8342949 |
ggacatggtaaacaaggaaaagttcttgaaattgtgtcttgttcttttgtgtagaaca |
8343006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University