View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SD37_low_8 (Length: 260)
Name: SD37_low_8
Description: SD37
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SD37_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 52033790 - 52033557
Alignment:
| Q |
11 |
cataggaaatagaaaagaagatactcatattaatgtgaccttgattattatatgcatccatatctatctcaaacttgttgttcacaatagctgtcacatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033790 |
cataggaaatagaaaagaagatactcatattaatgtgaccttgattattatatgcatccatatctatctcaaacttgttgttcacaatagctgtcacatt |
52033691 |
T |
 |
| Q |
111 |
gtatctcacaccttgagcagtgaatagttcattagagtatatggggaagtttttggcattatagagattaaatccccaataagccgttggaataagaatg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52033690 |
gtatctcacaccttgagcactgaatagttcattagagtatatggggaagtttttggcattatagagattaaatccccaataagccgttggaataagaatg |
52033591 |
T |
 |
| Q |
211 |
tagattaataaaatgtagccaacaaggatgttaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52033590 |
tagattaataaaatgtagccaacaaggatgttaa |
52033557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University