View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5572B-LTR4-TNT-insertion-11 (Length: 197)
Name: SO5572B-LTR4-TNT-insertion-11
Description: SO5572B-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5572B-LTR4-TNT-insertion-11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 106 - 169
Target Start/End: Original strand, 1537391 - 1537454
Alignment:
| Q |
106 |
gaagtattatgtggttcaacatttaagagttacttacataaaaatagatcaagtttactttaca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537391 |
gaagtattatgtggttcaacatttaagagttacttacataaaaatagatcaagtttactttaca |
1537454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 10 - 39
Target Start/End: Original strand, 421455 - 421484
Alignment:
| Q |
10 |
tcttacattgtatcagccagtgttgaattc |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
421455 |
tcttacattgtatcagccagtgttgaattc |
421484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University