View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5574B-LTR4-TNT-insertion-2 (Length: 373)
Name: SO5574B-LTR4-TNT-insertion-2
Description: SO5574B-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5574B-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 10 - 364
Target Start/End: Complemental strand, 13893386 - 13893032
Alignment:
| Q |
10 |
ttagtcactgtataaaacagaataagcaaatcaaggactttatgataggattttgaaattaatgttgggatcatgcctatgttaaatgttcataatgata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13893386 |
ttagtcactgtataaaacagaataagcaaatcaaggactttatgataggattttgaaattaatgttgggatcatgcctatgttaaatgttcataatgata |
13893287 |
T |
 |
| Q |
110 |
ttattatattctgatatacnnnnnnnnataagagagttttgtaatcttattgatttgcaaaaatatattttggatttgcaattatacctttaattttatc |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13893286 |
ttattatattctgatatacttttttttataagagagttttgtaatcttattgatttgcaaaaatatattttggatttgcaattatatctttaattttatc |
13893187 |
T |
 |
| Q |
210 |
ttcgttaaatcattaaggaaatcgaatatatattagtatcttcttataaagtagccaaatagttgcactaaaacaaatatcgctcttctttcttgtttct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13893186 |
ttcgttaaatcattaaggaaatcgaatatatattagtatcttcttataaagtagccaaatagttgcactaaaacaaatatcgctcttctttcttgtttct |
13893087 |
T |
 |
| Q |
310 |
tcccaaaccttagtattcttttgctaagagtttagaactagtaattcctcaattg |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13893086 |
tcccaaaccttagtattcttttgctaagagtttagaactagtaattcctcaattg |
13893032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University