View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5574B-LTR4-TNT-insertion-5 (Length: 295)
Name: SO5574B-LTR4-TNT-insertion-5
Description: SO5574B-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5574B-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 10 - 285
Target Start/End: Original strand, 42714621 - 42714896
Alignment:
| Q |
10 |
cgtatctgggtatgcccttcttgatttagaataaatgcttcccactttcattctgtcaagttagtctgtttcctcacgttcagtcttcaggttttgaaga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714621 |
cgtatctgggtatgcccttcttgatttagaataaatgcttcccactttcattctgtcaagttagtctgtttcctcacgttcagtcttcaggttttgaaga |
42714720 |
T |
 |
| Q |
110 |
aagctactaggctttatgctgctagccgggttcgtgacattgggcctgatcttcggccaaacgattataagacggatgaaatgaacgatgaatctaatgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714721 |
aagctactaggctttatgctgctagctgggttcgtgacattgggcctgatcttcggccaaacgattataagacggatgaaatgaacgatgaatctaatgc |
42714820 |
T |
 |
| Q |
210 |
tcaaaagaaaacagctaaagataaagaactctcaatagtggaggaactcggtaccatctctttctctggtttaatt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714821 |
tcaaaagaaaacagctaaagataaagaactctcaatagtggaggaactcggtaccatctctttctctggtttaatt |
42714896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University