View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5821A-LTR4-TNT-insertion-4 (Length: 159)
Name: SO5821A-LTR4-TNT-insertion-4
Description: SO5821A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5821A-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 4e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 4e-61
Query Start/End: Original strand, 9 - 151
Target Start/End: Complemental strand, 33715970 - 33715828
Alignment:
| Q |
9 |
caaacatgcgatcttagtaactgtttggacaaaataattcacactgtgatgtcctcttaatttattaaactgataattagtannnnnnnnggttaattga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33715970 |
caaacatgcgatcttagtaactgtttggacaaaataattcacactgtgatgtcctcttaatttattaaactgataattagtattttttttggttaattga |
33715871 |
T |
|
| Q |
109 |
ttttactgataatatatccagctgaaaatttagttttaaatta |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33715870 |
ttttactgataatatatccagctgaaaatttagttttaaatta |
33715828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University