View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5823A-LTR4-TNT-insertion-4 (Length: 220)
Name: SO5823A-LTR4-TNT-insertion-4
Description: SO5823A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5823A-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 15562394 - 15562193
Alignment:
| Q |
9 |
ggttcctgttagaaagtcacctgtggtgtgtataggccacctaggtttagatgggaagcagtgggattgtgggaagcagtgaaataaccacaaatatgtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15562394 |
ggttcctgttagaaagtcacctgtggtgtgtataggccacctaggtttagatgggaagcagtgggattgtgggaagcagtgaaataaccacaaatatgtg |
15562295 |
T |
|
| Q |
109 |
gatgtgttggaacccatagtgacatttccaaatggagtaatgcaaattgcttttgttcttgaagtataattttattttgcttttgttttgggaaaataat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15562294 |
gatgtgttggaacccatagtgacatttccaaatggagtaatgcaaattgcttttgttcttgaagtataattttattttgcttttgttttgggaaaataat |
15562195 |
T |
|
| Q |
209 |
ta |
210 |
Q |
| |
|
|| |
|
|
| T |
15562194 |
ta |
15562193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University