View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5928A-LTR4-TNT-insertion-2 (Length: 329)
Name: SO5928A-LTR4-TNT-insertion-2
Description: SO5928A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5928A-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 8 - 320
Target Start/End: Complemental strand, 11177457 - 11177145
Alignment:
| Q |
8 |
attattgcatgcttttattaatgttattgatgttttttatcttgacaaagttaatgttattgttgttgattgtgtagagtgaaggagcaaaaatgttgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177457 |
attattgcatgcttttattaatgttattgatgttttttatcttgacaaagttaatgttattgttgttgattgtgtagagtgaaggagcaaaaatgttgca |
11177358 |
T |
|
| Q |
108 |
atacataacatgtgccaagcaaacatcagaagatggggatgagcaagttcagcagagaggcacaccaactaccagagaagcccccaaaaatctgtctgcg |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177357 |
atgcataacatgtgccaagcaaacatcagaagatggggatgagcaagttcagcagagaggcacaccaactaccagagaagcccccaaaaatctgtctgcg |
11177258 |
T |
|
| Q |
208 |
caggtatactcttactctctcttagacctatgaattttgcttttgcagcttctttttccatcttgatgatgaaaacaaaactaaatcaagcccttttgag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11177257 |
caggtatactcttactctctcttagacctatgaattttgcttttgcagcttctttttccatcttgatgatgaaaacaaaactaaatcaagcccttttgag |
11177158 |
T |
|
| Q |
308 |
ggtaatccaattg |
320 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11177157 |
ggtaatccaattg |
11177145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University