View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5928A-LTR4-TNT-insertion-7 (Length: 179)
Name: SO5928A-LTR4-TNT-insertion-7
Description: SO5928A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5928A-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 170
Target Start/End: Complemental strand, 43711514 - 43711353
Alignment:
| Q |
9 |
gatgactagagagtaatcatatatccattttattttaaaattattagtttgaatcttacttactaaggtttaattttatattttcattgtgactttaaac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43711514 |
gatgactagagagtaatcatatatccattttattttaaaattattagtttgaatcttacttactaaggtttaattttatattttcattgtgactttaaac |
43711415 |
T |
|
| Q |
109 |
attactataaaatatgcaagctttcacgtgatgtcgcgtgacatgagaaaatgaaacaattg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43711414 |
attactataaaatatgcaagctttcacgtgatgtcgcgtgacatgagaaaatgaaacaattg |
43711353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University