View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5928A-LTR4-TNT-insertion-8 (Length: 295)
Name: SO5928A-LTR4-TNT-insertion-8
Description: SO5928A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5928A-LTR4-TNT-insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 8 - 286
Target Start/End: Original strand, 41742993 - 41743271
Alignment:
| Q |
8 |
caaaaaatgagtccacgaatgtatcttcaaggtatatagccctatagataatcttgctcagtgctataaccccggaaccaatttctccaccacggttcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742993 |
caaaaaatgagtccacgaatgtatcttcaaggtatatagccctatagataatcttgctcagtgctataaccccggaaccaatttctccaccacggttcat |
41743092 |
T |
|
| Q |
108 |
cattttgtgttaaatttttacccttttattattaaccattgaacttaagcacagatattaaagcaaggttattttaaaagctgaagcatattgtaatcca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743093 |
cattttgtgttaaatttttacccttttattattaaccattgaacttaagcacagatattaaagcaaggttattttaaaagctgaagcatattgtaatcca |
41743192 |
T |
|
| Q |
208 |
aggaaattttcagaaaaaatgccttacccggaacgcacgttgaaacatgttgatacgaaaccacgaagtcctataattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41743193 |
aggaaattttcagaaaaaatgccttacccggaacgcacgttgaaacatgttgatacgaaaccacgaagtcctacaattg |
41743271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University