View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5945A-LTR4-TNT-insertion-1 (Length: 117)
Name: SO5945A-LTR4-TNT-insertion-1
Description: SO5945A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5945A-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 1e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 54714066 - 54714163
Alignment:
| Q |
11 |
taaactagcttagttttgtcaaaatattattttctcaagcaaagccacattaattcacttattttttcgtttaaggaaaaatgttgtgttataaattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54714066 |
taaactagcttagttttgtcaaaatattattttctcaagcaaagccacattaattcacttattttttcgtttaaggaaaaatgttgtgttataaattg |
54714163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 5e-35
Query Start/End: Original strand, 11 - 105
Target Start/End: Original strand, 54720986 - 54721080
Alignment:
| Q |
11 |
taaactagcttagttttgtcaaaatattattttctcaagcaaagccacattaattcacttattttttcgtttaaggaaaaatgttgtgttataaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
54720986 |
taaactagcttagttttgtcaaaatattactttctcacgcaaagccacattaattcatttattttttcgtttaaggataaatgtggtgttataaa |
54721080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 11 - 108
Target Start/End: Original strand, 54680344 - 54680444
Alignment:
| Q |
11 |
taaactagcttagttttgtcaaaatattatt---ttctcaagcaaagccacattaattcacttattttttcgtttaaggaaaaatgttgtgttataaatt |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||| | |||||| ||||||||||| ||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
54680344 |
taaactagcttacttttgtcaaaatattactaatttctcacgcaaagccacactaattcatttattttttcgtttatggaaaaatgtggtgttataaatt |
54680443 |
T |
|
| Q |
108 |
g |
108 |
Q |
| |
|
| |
|
|
| T |
54680444 |
g |
54680444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University