View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO5945A-LTR4-TNT-insertion-6 (Length: 374)
Name: SO5945A-LTR4-TNT-insertion-6
Description: SO5945A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO5945A-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 8 - 364
Target Start/End: Complemental strand, 32547067 - 32546710
Alignment:
| Q |
8 |
gttactccattccattcacaacaaggtttgcttatattccaatgaacaagtttttt-gagatggttgagttgaatgtgaggttgttcttcaattgaagca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32547067 |
gttactccattccattcacaacaaggtttgcttatattccaatgaacaagtttttttgagatggttgagttgaatgtgaggttgttcttcaattgaagca |
32546968 |
T |
|
| Q |
107 |
acaaagattgttgatcaccaatagaatgactagtcacaaaaacaatattgatgatgaggtttatgaggcaaaagggtagcaagggaagcaacaaaattgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32546967 |
acaaagattgttgatcaccaatagaatgactagtcacaaaaacaatattgatgatgaggtttatgaggcaaaagggtagcaagggaagcaacaaaattgt |
32546868 |
T |
|
| Q |
207 |
tctcattggagataactatatatgagaaaacaaaattgctataaaaaatggtttaagcttgaagatgtgtttctgccttttgagcatatgatatctctac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32546867 |
tctcattggagataactatatatgagaaaacaaaattgctataaaaaatggtttaagcttgaagatgtgtttctgccttttgagcatatgatatctctac |
32546768 |
T |
|
| Q |
307 |
catttatacattcttttggcccatctttgacgctatgctatctttttcaaacttaatt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32546767 |
catttatacattcttttggcccatctttgacgctatgctatctttttcaaacttaatt |
32546710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 3750041 - 3750088
Alignment:
| Q |
75 |
gttgaatgtgaggttgttcttcaattgaagcaacaaagattgttgatc |
122 |
Q |
| |
|
|||||||||||| ||||| || |||||||||||||| ||||||||||| |
|
|
| T |
3750041 |
gttgaatgtgagattgttttttaattgaagcaacaatgattgttgatc |
3750088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University