View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6003A-LTR4-TNT-insertion-2 (Length: 243)
Name: SO6003A-LTR4-TNT-insertion-2
Description: SO6003A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6003A-LTR4-TNT-insertion-2 |
 | |
|
| [»] scaffold0201 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 234
Target Start/End: Original strand, 1981916 - 1982142
Alignment:
| Q |
8 |
gaccttgtcctcaaggtcaaagattccataaatagagactcatttaggtggttttggaggtgggggaatggtgggatttgagaacaattcttttctactg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1981916 |
gaccttgtcctcaaggtcaaagattccataaatagagactcatttaggtggttttggaggtgggggaatggtgggatttgagaacaattcttttctactg |
1982015 |
T |
|
| Q |
108 |
gagattgtggatctactggtttcgggagaggggacgacaccagagaaagggcagagatcgacgatgatggtggctgagttttgagcagattcagttgctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1982016 |
gagattgtggatctactggtttcgggagaggggacgacaccagagaaagggcagagatcgacgatgatggtggctgagttttgagcagattcagttgctt |
1982115 |
T |
|
| Q |
208 |
caatggtggattcaatgacttcaattg |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1982116 |
caatggtggattcaatgacttcaattg |
1982142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0201 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0201
Description:
Target: scaffold0201; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 21092 - 21030
Alignment:
| Q |
8 |
gaccttgtcctcaaggtcaaagattccataaatagagactcatttaggtggttttggaggtgg |
70 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
21092 |
gaccttgtcctcaaagtcaatgattccgtaaatagagacgcaattaggtggttttggaggtgg |
21030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 23488485 - 23488423
Alignment:
| Q |
8 |
gaccttgtcctcaaggtcaaagattccataaatagagactcatttaggtggttttggaggtgg |
70 |
Q |
| |
|
|||||||||||||| ||||| |||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
23488485 |
gaccttgtcctcaaagtcaatgattccgtaaatagagatgcaattaggtggttttggaggtgg |
23488423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 210
Target Start/End: Original strand, 37089542 - 37089594
Alignment:
| Q |
158 |
gcagagatcgacgatgatggtggctgagttttgagcagattcagttgcttcaa |
210 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
37089542 |
gcagagattaacgatggtggcggctgagttttgagcagattcagtcgcttcaa |
37089594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 37089425 - 37089469
Alignment:
| Q |
20 |
aaggtcaaagattccataaatagagactcatttaggtggttttgg |
64 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
37089425 |
aaggtcaaagattccataaatagagatgcattcatgtggttttgg |
37089469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University