View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6003A-LTR4-TNT-insertion-8 (Length: 124)
Name: SO6003A-LTR4-TNT-insertion-8
Description: SO6003A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6003A-LTR4-TNT-insertion-8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 10 - 114
Target Start/End: Complemental strand, 40585622 - 40585518
Alignment:
| Q |
10 |
gatagcatgagagacagaacttccgaacaacgcgagatttgctgagagtgaggacagtgttgacgaaaacggagaagatcaagaactgttcgtcgttatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40585622 |
gatagcatgagagacagaacttccgaacaacgcgagatttgcggagagtgaggacagtgttgacgaaaacggagaagatcaagaactgttcgtcgttatc |
40585523 |
T |
|
| Q |
110 |
gaatt |
114 |
Q |
| |
|
||||| |
|
|
| T |
40585522 |
gaatt |
40585518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 102
Target Start/End: Complemental strand, 26026577 - 26026493
Alignment:
| Q |
18 |
gagagacagaacttccgaacaacgcgagatttgctgagagtgaggacagtgttgacgaaaacggagaagatcaagaactgttcgt |
102 |
Q |
| |
|
||||||| |||||||||||| ||||| || | ||||| ||||||||||||||||||||||| ||| | || ||| ||||||| |
|
|
| T |
26026577 |
gagagacggaacttccgaacgacgcgtgagcgacggagagagaggacagtgttgacgaaaacggtgaacagcatgaattgttcgt |
26026493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University