View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6003A-LTR4-TNT-insertion-9 (Length: 122)
Name: SO6003A-LTR4-TNT-insertion-9
Description: SO6003A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6003A-LTR4-TNT-insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 6e-50; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 9 - 112
Target Start/End: Complemental strand, 26238827 - 26238724
Alignment:
| Q |
9 |
tctcttcttttttccactttctcttttaatagataacttgtatatttattatagcttttgtgcgtataaaacatgaacataaacctgaagattacttaca |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26238827 |
tctcttctttttttcactttctcttttaatagataacttgtatatttattatagcttttgtgcgtataaaacatgaacataaacctgaagattacttaca |
26238728 |
T |
|
| Q |
109 |
atta |
112 |
Q |
| |
|
|||| |
|
|
| T |
26238727 |
atta |
26238724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 8e-28
Query Start/End: Original strand, 9 - 112
Target Start/End: Complemental strand, 26211620 - 26211511
Alignment:
| Q |
9 |
tctcttcttttttccactttctcttttaatagataacttgtatatt------tattatagcttttgtgcgtataaaacatgaacataaacctgaagatta |
102 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26211620 |
tctcttctttttttcaccttctcttttaatagataacttgtatcttatatattattatagcttttgtgtgtataaaacatgatcataaacctgaagatta |
26211521 |
T |
|
| Q |
103 |
cttacaatta |
112 |
Q |
| |
|
||||| |||| |
|
|
| T |
26211520 |
cttactatta |
26211511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 9 - 114
Target Start/End: Complemental strand, 26116563 - 26116452
Alignment:
| Q |
9 |
tctcttcttttttccactttctcttttaatagataacttgtat-------atttattatagcttttgtgcgtataaaacatgaacataaacctgaagatt |
101 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||| |||||||||||| ||||||| |||||||||||| || ||||||||||||| |
|
|
| T |
26116563 |
tctcttcttttttc-actttctcttttgatagatagcttgtatcttatatatttattatagcatttgtgcatataaaacatgatcacaaacctgaagatt |
26116465 |
T |
|
| Q |
102 |
acttacaattagg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
26116464 |
acttactattagg |
26116452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 9 - 113
Target Start/End: Complemental strand, 26182986 - 26182877
Alignment:
| Q |
9 |
tctcttcttttttccactttctcttttaatagataacttgtat-------atttattatagcttttgtgcgtataaaacatgaacataaacctgaagatt |
101 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||| |||||||||||| ||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
26182986 |
tctcttcttttttc-actttctcttttgatagatagcttgtatcttatatatttattatagcattt-tgcatataaaacatgatcataaacctgaagatt |
26182889 |
T |
|
| Q |
102 |
acttacaattag |
113 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
26182888 |
acttactattag |
26182877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 26144494 - 26144431
Alignment:
| Q |
49 |
tatatttattatagcttttgtgcgtataaaacatgaacataaacctgaagattacttacaatta |
112 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||| | |||||||||||| |||| |
|
|
| T |
26144494 |
tatatttattatagcctttgtgcatataaaacatgatcataaacttaaagattacttactatta |
26144431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University