View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6103A-LTR4-TNT-insertion-2 (Length: 160)
Name: SO6103A-LTR4-TNT-insertion-2
Description: SO6103A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6103A-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 8 - 151
Target Start/End: Original strand, 23590152 - 23590295
Alignment:
| Q |
8 |
gttacaacttatattgcaaggaagctgaactgcagactttcagttattgacaactacaggtttttaaaagaatatgcattaaatgttgatgaaattttcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23590152 |
gttacaacttatattgcaaggaagctgaactgcagactttcagttattgacaactacaggtttttaaaagaatatgcattaaatgttgatgaaattttcc |
23590251 |
T |
 |
| Q |
108 |
ttgctaggactctcggttcatctattaaatgggtatgacaattg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23590252 |
ttgctaggactctcggttcatctattaaatgggtatgacaattg |
23590295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University