View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6142A-LTR4-TNT-insertion-1 (Length: 132)
Name: SO6142A-LTR4-TNT-insertion-1
Description: SO6142A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6142A-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 11 - 123
Target Start/End: Original strand, 4492622 - 4492734
Alignment:
| Q |
11 |
tctggttatcacttgattttaatttggtctttctaagaattggttattttcaacttcgttactacttcctacttacacctcactcttatctcatgacact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4492622 |
tctggttatcacttgattttaatttggtctttctaagaattggttattttcaacttcgttactacttcctacttacacctcactcttatctcatgacact |
4492721 |
T |
|
| Q |
111 |
ccaatacagatta |
123 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4492722 |
ccaatacagatta |
4492734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University