View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6142A-LTR4-TNT-insertion-8 (Length: 276)
Name: SO6142A-LTR4-TNT-insertion-8
Description: SO6142A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6142A-LTR4-TNT-insertion-8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 266
Target Start/End: Complemental strand, 50030395 - 50030137
Alignment:
| Q |
8 |
gagttgtgattttccttcttagaaattcctataaatgtgttgcttcaaacctcagtaaatcttgtgtatatattccctgttcactttcttcgtgtttcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50030395 |
gagttgtgattttccttcttagaaattcctataaatgtgttgcttcaaacctcagtaaatcttgtgtatatattccctgttcactttcttcgtgtttcta |
50030296 |
T |
 |
| Q |
108 |
atttgcttgatagtttttggtttcaatccgatttcaagaatctattacttgaatttttcatctattatcgtttcataagagcgttggagtgcaagattga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50030295 |
atttgcttgatagtttttggtttcaatccgatttcaagaatctattacttgaatttttcatctattatcgtttcataagagcgttggagtgcaagattga |
50030196 |
T |
 |
| Q |
208 |
taaaatgaacgcacactcgaacacatggaattcatgtcaagtgaaacaattctaaatta |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50030195 |
taaaatgaacgcacactcgaacacatggaattcatgtcaagtgaaacaattctaaatta |
50030137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 7698009 - 7698079
Alignment:
| Q |
139 |
tttcaagaatctattacttgaatttttcatctattatcgtttcataagagcgttggagtgcaagattgataaaa |
212 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||| |||| ||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
7698009 |
tttcaagaatcttttagttgaattttccatttatt---gtttcataagagcattggagtgcgacattgataaaa |
7698079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University