View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6207A-LTR4-TNT-insertion-1 (Length: 180)
Name: SO6207A-LTR4-TNT-insertion-1
Description: SO6207A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6207A-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 10 - 170
Target Start/End: Original strand, 3679017 - 3679177
Alignment:
| Q |
10 |
gtcacttctatataacaaaatatatannnnnnnatttacaaaacaaactataatttacctacaataatccacttgggttgatctggtggcaatgacctga |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679017 |
gtcacttctatataacaaaatatatatttttttatttacaaaacaaactataatttacctacaataatccacttgggttgatctggtggcaatgacctga |
3679116 |
T |
|
| Q |
110 |
aaccttggagtgtgctcctcttaatatttcgtttgattctcttaccaatttcagtggatta |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3679117 |
aaccttggagtgtgctcctcttaatatttcgtttgattctcttaccaatttcagtggatta |
3679177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University