View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6207A-LTR4-TNT-insertion-3 (Length: 355)
Name: SO6207A-LTR4-TNT-insertion-3
Description: SO6207A-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6207A-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 10 - 346
Target Start/End: Complemental strand, 39005520 - 39005184
Alignment:
| Q |
10 |
tgtgcctactgtttttgataatttcagtgcaaatgttgtgcttgatggcagcacagttaatcttggattatgggacactgctggtaaccattttctttag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39005520 |
tgtgcctactgtttttgataatttcagtgcaaatgttgtggttgatggcagcacagttaatcttggattatgggacactgctggtaaccattttctttag |
39005421 |
T |
|
| Q |
110 |
gcggtaacgaatctacgtcttacaatttacaatatttattaaatttttgtggcttcataaaaattcaggacaagaggattataacaggcttaggccattg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39005420 |
gcggtaacgaatctacgtcttacaatttacaatatttattaaatttttgtggcttcataaaaattcaggacaagaggattataacaggcttaggccattg |
39005321 |
T |
|
| Q |
210 |
agctatagaggagcagatgtgtttttgttggccttttcactactcagcagagccagctatgagaatatatctaaaaaggttattgtgacacatttattca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39005320 |
agctatagaggagcagatgtgtttttgttggccttttcactactcagcagagccagctatgagaatatatctaaaaaggttattgtgacacatttattca |
39005221 |
T |
|
| Q |
310 |
cttgtgaatttttatatggtatagttttatttaattg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39005220 |
cttgtgaatttttatatggtatagttttattcaattg |
39005184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 17 - 90
Target Start/End: Original strand, 34676519 - 34676592
Alignment:
| Q |
17 |
actgtttttgataatttcagtgcaaatgttgtgcttgatggcagcacagttaatcttggattatgggacactgc |
90 |
Q |
| |
|
||||| ||||| ||||||||||| ||||| ||| | ||||| || |||||||||||||| |||||||| ||||| |
|
|
| T |
34676519 |
actgtgtttgacaatttcagtgctaatgtagtggtggatggtagtacagttaatcttggtttatgggatactgc |
34676592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 175 - 239
Target Start/End: Original strand, 34676677 - 34676741
Alignment:
| Q |
175 |
caggacaagaggattataacaggcttaggccattgagctatagaggagcagatgtgtttttgttg |
239 |
Q |
| |
|
|||||||||| ||||| || || | ||||||||||| || |||||||| ||||||||||||||| |
|
|
| T |
34676677 |
caggacaagaagattacaatagattaaggccattgagttacagaggagctgatgtgtttttgttg |
34676741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 35253760 - 35253833
Alignment:
| Q |
174 |
tcaggacaagaggattataacaggcttaggccattgagctatagaggagcagatgtgtttttgttggccttttc |
247 |
Q |
| |
|
||||| ||||||||||| || ||||| ||||| |||||||| ||||| |||||||| ||| | ||||| ||||| |
|
|
| T |
35253760 |
tcagggcaagaggattacaataggctgaggcctttgagctacagaggggcagatgtctttgtcttggctttttc |
35253833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University