View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6232B-LTR4-TNT-insertion-4 (Length: 268)
Name: SO6232B-LTR4-TNT-insertion-4
Description: SO6232B-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6232B-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 199 - 258
Target Start/End: Complemental strand, 28534763 - 28534704
Alignment:
| Q |
199 |
ggatatgtttgtgacaagttggcaaggcaagtggacatgactataataaggtaattatta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28534763 |
ggatatgtttgtgacaagttggcaaggcaagtggacatgactataataaggtaattatta |
28534704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 28534952 - 28534898
Alignment:
| Q |
10 |
tgaagaagccatgaatgaaggtgatagggacataaattgaaaaggaaaattggtc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28534952 |
tgaagaagccatgaatgaaggtgatagggacataaattgaaaaggaaaattggtc |
28534898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University