View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: SO6324B-LTR4-TNT-insertion-1 (Length: 227)
Name: SO6324B-LTR4-TNT-insertion-1
Description: SO6324B-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] SO6324B-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 21197121 - 21196914
Alignment:
| Q |
10 |
tagaacaactttagagtggtgtcaaagacattcaattttgttttcttatgcaagtcaaaattcatagtttgttaatctacagtactctagtgtatgtatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21197121 |
tagaacaactttagagtggtgtcaaagacattcaattttgttttcttatgcaagtcaaaattcatagtttgttaatctacagtactctagtgtatgtatg |
21197022 |
T |
|
| Q |
110 |
taagattgtgtcttgaaaaatatgaacaaagattggatcattattggtcagatatcactctcaacatgttcttgttgccaaaataagaagaaagatagat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21197021 |
taagattgtgtcttgaaaaatatgaacaaagattggatcattattggtcagatatcactctcaacatgttcttgttgccaaaataagaagaaagatagat |
21196922 |
T |
|
| Q |
210 |
agatatta |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
21196921 |
agatatta |
21196914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 104 - 203
Target Start/End: Complemental strand, 21203588 - 21203489
Alignment:
| Q |
104 |
tgtatgtaagattgtgtcttgaaaaatatgaacaaagattggatcattattggtcagatatcactctcaacatgttcttgttgccaaaataagaagaaag |
203 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
21203588 |
tgtatgtgagattgtgtcatgaaaaatatgaacaaagattggatcattattggtcgaatatcactctcaacaagttcttgttaccaaagtaagaagaaag |
21203489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 21203701 - 21203631
Alignment:
| Q |
13 |
aacaactttagagtggtgtcaaagacattcaattttgttttcttatgcaagtcaaaattcatagtttgtta |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
21203701 |
aacaactttagagtggtgtcaaagacattcaatttttttttcttatgcaagtaaaaattcatagtttgtta |
21203631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 21850954 - 21850914
Alignment:
| Q |
12 |
gaacaactttagagtggtgtcaaagacattcaattttgttt |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
21850954 |
gaacaactttagagtggtgtcaaagacatcctattttgttt |
21850914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 21181046 - 21181003
Alignment:
| Q |
10 |
tagaacaactttagagtggtgtcaaagacattcaattttgtttt |
53 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
21181046 |
tagaacaactttagagtagtgtcaaagacatccaatttagtttt |
21181003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University