View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-11 (Length: 75)
Name: Solexa-NF5668-11
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 7e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 7 - 75
Target Start/End: Complemental strand, 35410205 - 35410137
Alignment:
| Q |
7 |
agttttctgtgcaatgagcttggttttacttgttctttcatttgttctttcactaagtgaagaagataa |
75 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410205 |
agttttctgctcaatgagcttggttttacttgttctttcatttgttctttcactaagtgaagaagataa |
35410137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University