View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-14 (Length: 96)
Name: Solexa-NF5668-14
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 21 - 96
Target Start/End: Complemental strand, 33113210 - 33113135
Alignment:
| Q |
21 |
gtattatccaataaataaaagagaatcttcgcatgttaatctttttaattaaaattttccgtaacggtcttcccat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33113210 |
gtattatccaataaataaaagagaatcttcgcatgttaatcttgttaattaaaattttccgtaacggtcttcccat |
33113135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University