View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-16 (Length: 190)
Name: Solexa-NF5668-16
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 6 - 190
Target Start/End: Complemental strand, 38584341 - 38584157
Alignment:
| Q |
6 |
cagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagttgtttgcgttct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38584341 |
cagttatatcagaggactatttcctgagaagtacttcaatgacaagtctgttcccgcgttaggtaaaatcactattcagtcctccagttgtttgcgtttt |
38584242 |
T |
|
| Q |
106 |
ttactgtttagtgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatgaagat |
190 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584241 |
ttactgtttaatgtttacactgaatcttctagtatttgtccttgaatttaacctataactatgctttaataacagagatgaagat |
38584157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University