View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-22 (Length: 127)
Name: Solexa-NF5668-22
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 34760453 - 34760334
Alignment:
| Q |
8 |
gtcagtgccttcaaattcaatatcaaagtttaagatatttagaaaacagtaacctcaatgatatttttacacataaatttgacagtaaatttcaacaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34760453 |
gtcagtgccttcaaattcaatatcaaagtttaagatatttagaaaatagtaacctcaatgatatttttacacataaatttgacagtaaatttcaacaaca |
34760354 |
T |
|
| Q |
108 |
atttggatggtcaacacaat |
127 |
Q |
| |
|
||||||||||| | |||||| |
|
|
| T |
34760353 |
atttggatggttagcacaat |
34760334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 70 - 116
Target Start/End: Complemental strand, 35223789 - 35223743
Alignment:
| Q |
70 |
atttttacacataaatttgacagtaaatttcaacaacaatttggatg |
116 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
35223789 |
attttgacaaataaatttgacaataaatttcaacaaaaatttggatg |
35223743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University