View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-31 (Length: 196)
Name: Solexa-NF5668-31
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 186
Target Start/End: Original strand, 47339538 - 47339717
Alignment:
| Q |
7 |
acctgagcttcctgaacttggaagacgaaggagcaattgctatagctaatgctcttaaggcatcagctccttgccttgaagttctcgagatgagtggaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47339538 |
acctgagcttcctgaacttggaagacgaaggagcaattgctatagctaatgctcttaaggcatcagctcctcgccttgaagttctcgagatgagtggaaa |
47339637 |
T |
|
| Q |
107 |
cgatattacagttgatgctgctcctgctatagcaaactgccttgcagccaagcagtttcttgccaagttgaacctctctg |
186 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47339638 |
caatattacagttgatgctgctcctgctatagcaaactgccttgcagccaagcagtttcttgccaagttgaacctctctg |
47339717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University