View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-32 (Length: 142)
Name: Solexa-NF5668-32
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-32 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 32395841 - 32395982
Alignment:
| Q |
1 |
gcagagattgatgatatttgttattgttttttgttttatgctgttttgaaatttgtcagaatctttgaagtacagttctggaatatcaactcttcttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32395841 |
gcagagattgatgatatttgttattgttttttgttttatgctgttttgaaatttgtcagaatctttgaagtacagttctggaatatcaactcttcttgct |
32395940 |
T |
|
| Q |
101 |
gtggcatttgttaccatttgttctgcgttggctattgttgct |
142 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32395941 |
gtggcatttgttaccatttgttctgggttggctattgttgct |
32395982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 74 - 141
Target Start/End: Original strand, 36138861 - 36138928
Alignment:
| Q |
74 |
agttctggaatatcaactcttcttgctgtggcatttgttaccatttgttctgcgttggctattgttgc |
141 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||||||||||| | ||||||| ||||| |||||||| |
|
|
| T |
36138861 |
agttctgcagtatcaactcttctagctgtggcatttgttacaacatgttctgtcttggcaattgttgc |
36138928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University