View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-38 (Length: 129)
Name: Solexa-NF5668-38
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-38 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 10 - 129
Target Start/End: Complemental strand, 7950362 - 7950247
Alignment:
| Q |
10 |
cgaacaatctgttgctccaaccttctttgtcggaaccaatgctgtaaatgacacatagacaattagagctggaagnnnnnnnnncatacaattacttgaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7950362 |
cgaacaatctgttgctccaaccttcttcgtcggaaccaatgctgtaaatgacacatagacaattagagctggaa----aaaaaacatacaattacttgaa |
7950267 |
T |
|
| Q |
110 |
ataataaattagtggtaaat |
129 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7950266 |
ataataaattagtggtaaat |
7950247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University