View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-40 (Length: 138)
Name: Solexa-NF5668-40
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 38053186 - 38053052
Alignment:
| Q |
1 |
agagtggacggaaatataattcaacaaaccgaattaattcgttaggtcgtttgattagtattcgtaatatcaatcattttccatattataaataacattc |
100 |
Q |
| |
|
||||||| ||||||||||||||||| || | |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38053186 |
agagtggtcggaaatataattcaacgaatcaaattaatttgttagatcgtttgattagtattcgtaatatcaatcattttccatattataagtaacattc |
38053087 |
T |
 |
| Q |
101 |
ctaacatgtctaattaatgcaaattttaacataga |
135 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38053086 |
ctaacatgtctaattaatgcaaagtttaacataga |
38053052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University