View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-47 (Length: 107)
Name: Solexa-NF5668-47
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 1414419 - 1414312
Alignment:
| Q |
1 |
ggtggtaatgcacaattaatttgtaaataaa-ctatttgtgttttctgcaggtaaaatcttcatctttcacaagactatgtagtaccaagaacatcttga |
99 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414419 |
ggtggtaacgcacaattaatttgtaaataaaactatttgtgttttctgcaggtaaaatcttcatctttcacaagactatgtagtaccaagaacatcttga |
1414320 |
T |
 |
| Q |
100 |
cggtaaat |
107 |
Q |
| |
|
|||||||| |
|
|
| T |
1414319 |
cggtaaat |
1414312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University