View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-50 (Length: 129)
Name: Solexa-NF5668-50
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-50 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 20 - 129
Target Start/End: Complemental strand, 38052612 - 38052503
Alignment:
| Q |
20 |
ttgaggtaccggattgaagagattgaatgctttttgtatatacttgtgtcatgtccaaataagttatctagatgtctcttaacgattcttaatgtccaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
38052612 |
ttgaggtaccggattgaagagattgaatattttttgtatatacttgtgtcatgtccaaataagttctctagatgtctcttaacgactcttaatgtccaaa |
38052513 |
T |
|
| Q |
120 |
taagctctct |
129 |
Q |
| |
|
|| ||||||| |
|
|
| T |
38052512 |
tacgctctct |
38052503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University