View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-53 (Length: 156)
Name: Solexa-NF5668-53
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-53 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 3e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 3e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 38052220 - 38052375
Alignment:
| Q |
1 |
taaacatagttccatcaaactttttgatagagtctgaaactaaaatacaaaccataacaaattgtttaaatctctgtaagttgatgttttggtgctcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052220 |
taaacatagttccatcaaactttttgatagagtctgaaactaaaatacaaaccataacaaattgtttaaatctctgtaagttgatgttttggtgctcttt |
38052319 |
T |
 |
| Q |
101 |
aaattgggatttaattatattaaaaagcatacaacctagtgattatgatattgttt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052320 |
aaattgggatttaattatattaaaaagcatacaacctagtgattatgatattgttt |
38052375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University