View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5668-54 (Length: 127)

Name: Solexa-NF5668-54
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5668-54
Solexa-NF5668-54
[»] chr4 (1 HSPs)
chr4 (8-127)||(51273578-51273697)
[»] chr6 (1 HSPs)
chr6 (10-125)||(14907657-14907773)
[»] chr1 (1 HSPs)
chr1 (15-127)||(5051679-5051790)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 51273697 - 51273578
Alignment:
8 caaagtatggtgatgaagaattgatcgttcaatgaattggagctgtgagattaaagctaagaaacgctttgagattgatttgcaactcactgctgtcttg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
51273697 caaagtatggtgatgaagaattgatcgttcaatgaattggagctgtgagattaaagctaagaaacgctttgagatggatttgcaactcactgctgtcttg 51273598  T
108 tatgaaacacgactccatat 127  Q
    || |||||||||||||||||    
51273597 tacgaaacacgactccatat 51273578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 3e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 10 - 125
Target Start/End: Complemental strand, 14907773 - 14907657
Alignment:
10 aagtatggtgatgaagaattgatcgttcaatgaattggagctgtgagatt-aaagctaagaaacgctttgagattgatttgcaactcactgctgtcttgt 108  Q
    ||||||||||||||| ||| |||| ||||||||||||||| | ||| ||| ||||||||||  ||||||||||| |||||| ||||||||| ||| ||||    
14907773 aagtatggtgatgaataatggatcattcaatgaattggagatttgaaatttaaagctaagatgcgctttgagatggatttgtaactcactgatgttttgt 14907674  T
109 atgaaacacgactccat 125  Q
    ||||||||||| |||||    
14907673 atgaaacacgaatccat 14907657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 3e-24; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 3e-24
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 5051679 - 5051790
Alignment:
15 tggtgatgaagaattgatcgttcaatgaattggagctgtgagattaaagctaagaaacgctttgagattgatttgcaactcactgctgtcttgtatgaaa 114  Q
    ||||||||||||| ||  |||||| |||||||||||||||||||||  |||||||| ||||||| ||| |||||||| |||||| ||||||||||||  |    
5051679 tggtgatgaagaactggccgttcattgaattggagctgtgagattattgctaagaagcgctttgcgatggatttgcatctcactcctgtcttgtatg-ga 5051777  T
115 cacgactccatat 127  Q
    |||||||||||||    
5051778 cacgactccatat 5051790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University