View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-61 (Length: 120)
Name: Solexa-NF5668-61
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 9e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 9e-43
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 40427036 - 40427154
Alignment:
| Q |
1 |
ggaggcaacggtaatttcttttcattcacttcttgttgcatgctccatannnnnnnnncttgccttcactaacaagtaacaacacatattttataccaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40427036 |
ggaggcaacggtaatttcttttcattcacttcttgtttcatgctccatatttttttttcttgccttcactaacaagtaacaacacatattttataccaaa |
40427135 |
T |
 |
| Q |
101 |
tgcacctttgagctttaga |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40427136 |
tgcacctttgagctttaga |
40427154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University