View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-62 (Length: 120)
Name: Solexa-NF5668-62
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 6 - 112
Target Start/End: Complemental strand, 47423736 - 47423630
Alignment:
| Q |
6 |
cacagtcatggattcatcactggtgaagtcatttgcgctttgctttggggaaggtcgtggaagtcgaagacggcggacgagaatcgttgatcatgattca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47423736 |
cacagtcatggattcatcactggtgaagtcatttgcgctttgctttggggaaggtcgtggaagtcgaagacggcggacgagaatcgttgatcatgattca |
47423637 |
T |
|
| Q |
106 |
tcaccgg |
112 |
Q |
| |
|
||||||| |
|
|
| T |
47423636 |
tcaccgg |
47423630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University