View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-64 (Length: 210)
Name: Solexa-NF5668-64
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 8 - 198
Target Start/End: Complemental strand, 25658112 - 25657924
Alignment:
| Q |
8 |
ggcggaagttgtatgagtattgaattaggacttttttgaatgtggcttagctctagagatgtgtggaggatgttttgacttttatgggtgttgttttggg |
107 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||||||||||||| | |||||||||||||||||||||| |||||| |||| ||| ||||||||||| |
|
|
| T |
25658112 |
ggcggaagttgtattagtattggattaaaacttttttgaatgtggctcaactctagagatgtgtggaggatgctttgacctttacgggcgttgttttggg |
25658013 |
T |
|
| Q |
108 |
gtgaatagtggcaatgggtggttattgattcgtttttagtggttgtatacgatagagtctgattttggtggtgaggtttcttttggtggtt |
198 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||||||||||||||| |||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25658012 |
gtgagtagtggcaatgagtggttatgaattcgtttttagtggttgtttacg--acagtctaattttggtggtgaggtttcttttggtggtt |
25657924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 36 - 198
Target Start/End: Complemental strand, 33383765 - 33383603
Alignment:
| Q |
36 |
gacttttttgaatgtggcttagctctagagatgtgtggaggatgttttgacttttatgggtgttgttttggggtgaatagtggcaatgggtggttattga |
135 |
Q |
| |
|
||||||||||| |||||| |||| | |||||| | ||||||||||| ||||||| ||||||| ||||||||||| ||||||| |||||||||||| || |
|
|
| T |
33383765 |
gacttttttgagtgtggcgcagctatggagatgagcagaggatgttttaacttttaagggtgtttttttggggtgagtagtggcgatgggtggttatgga |
33383666 |
T |
|
| Q |
136 |
ttcgtttttagtggttgtatacgatagagtctgattttggtggtgaggtttcttttggtggtt |
198 |
Q |
| |
|
||||||| | |||| || | ||| ||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
33383665 |
ttcgtttccaatggtggtttgcgaaagagtctgattttagtggtgagatttattttggtggtt |
33383603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 198
Target Start/End: Original strand, 27905616 - 27905712
Alignment:
| Q |
103 |
ttggggtgaatagtggcaatgggtggttattgat-tcgtttttagtggttgtatacgatagagtctgattttggtggtgaggtttcttttggtggtt |
198 |
Q |
| |
|
||||||||| ||||||| ||| ||| |||| ||| |||||||||||||| || | | | |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27905616 |
ttggggtgagtagtggcgatgagtgattatggatatcgtttttagtggtggtttgcaacgaagtctgattttggtggtgaggtttattttggtggtt |
27905712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University