View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-66 (Length: 140)
Name: Solexa-NF5668-66
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-66 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 47422976 - 47423114
Alignment:
| Q |
1 |
aagaaaaggtaatctagcaaatgcttataacaaaaggataattttactcatttatatcta-ctgtatatgttattttaggatataataatttcgagtaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47422976 |
aagaaaaggtaatctagcaaatgcttataacaaaag-ataattttactcatttatatctaactgtatatgttattttaggatataataatttcgagtaga |
47423074 |
T |
 |
| Q |
100 |
attaattctgcaacctctaaaatcacttttgatcctctaaa |
140 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
47423075 |
attaattctgcaacctctaaaatca-ttttgattctctaaa |
47423114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University