View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-7 (Length: 199)
Name: Solexa-NF5668-7
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 51 - 178
Target Start/End: Complemental strand, 30267132 - 30267005
Alignment:
| Q |
51 |
tatcttaaaaacacaatattttgctatgaagcacaaacccaaacacgaacaccagacacgacattgacacttgagaaaatgaattattgaacataatcac |
150 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30267132 |
tatcttaaaaacactatattttgctatgaagcacaaacccaaacacgaacaccagacacgacattgacacttgagaaaatgaattattgaacataatcac |
30267033 |
T |
|
| Q |
151 |
gtgtcagacaccagacacatyttggatc |
178 |
Q |
| |
|
|||||||||||||||||||| || |||| |
|
|
| T |
30267032 |
gtgtcagacaccagacacatctttgatc |
30267005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 53795488 - 53795531
Alignment:
| Q |
10 |
tccaacccccaaaacaaccaaaccttcaatttcactaccattat |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53795488 |
tccaacccccaaaacaaccaaaccttcaatttcactaccattat |
53795531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 74 - 113
Target Start/End: Original strand, 30563373 - 30563412
Alignment:
| Q |
74 |
ctatgaagcacaaacccaaacacgaacaccagacacgaca |
113 |
Q |
| |
|
|||||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
30563373 |
ctatgaagcacatacacaaacacgaacactagacacgaca |
30563412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University