View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-73 (Length: 149)
Name: Solexa-NF5668-73
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-73 |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 14 - 108
Target Start/End: Original strand, 21549760 - 21549854
Alignment:
| Q |
14 |
aggagaaaatggtagttatttcgttcaagttgtagtttcctagatgaagatggttttgagagtgggggtgcactagcactcacaagttggaaacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21549760 |
aggagaaaatggtagttatttcgttcaagttgtagtttcctagatgaagatggttatgagagtgggggtgcactagcactcacaagttggaaacc |
21549854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 1468 - 1416
Alignment:
| Q |
56 |
gatgaagatggttttgagagtgggggtgcactagcactcacaagttggaaacc |
108 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
1468 |
gatgaagatggttatgagagtgcgggtgcactagtggtcacaagttgggaacc |
1416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 57 - 89
Target Start/End: Complemental strand, 16263322 - 16263290
Alignment:
| Q |
57 |
atgaagatggttttgagagtgggggtgcactag |
89 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
16263322 |
atgaagatggttttgagagtgcgggtgcactag |
16263290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 57 - 108
Target Start/End: Original strand, 9602974 - 9603025
Alignment:
| Q |
57 |
atgaagatggttttgagagtgggggtgcactagcactcacaagttggaaacc |
108 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
9602974 |
atgaagatggttatgagagtgcgggtgcactagtggtcacaagttgggaacc |
9603025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 21987880 - 21987829
Alignment:
| Q |
57 |
atgaagatggttttgagagtgggggtgcactagcactcacaagttggaaacc |
108 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
21987880 |
atgaagatggttatgagagtgcgggtgcactagtggtcacaagttgggaacc |
21987829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 57 - 108
Target Start/End: Complemental strand, 49090649 - 49090598
Alignment:
| Q |
57 |
atgaagatggttttgagagtgggggtgcactagcactcacaagttggaaacc |
108 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
49090649 |
atgaagatggttatgagagtgcgggtgcactagtggtcacaagttgggaacc |
49090598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 56 - 103
Target Start/End: Complemental strand, 24077891 - 24077844
Alignment:
| Q |
56 |
gatgaagatggttttgagagtgggggtgcactagcactcacaagttgg |
103 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||| ||||||||||| |
|
|
| T |
24077891 |
gatgaagatggttatgagagtgcgggtgcattagcgatcacaagttgg |
24077844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University