View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-91 (Length: 125)
Name: Solexa-NF5668-91
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-91 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 8e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 8e-45
Query Start/End: Original strand, 27 - 125
Target Start/End: Complemental strand, 28958541 - 28958443
Alignment:
| Q |
27 |
ctttgcatcctagtgatgtttaaagactaggaataacttctaattccatagcgaagcattgtaacaaagtatgtgaattcagttcatgctgaagcaaca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28958541 |
ctttgcatcctagtgatgtttaaagactaggaataacttctaattccatagcgaagcattgtaacaaagtatgtgaattcagttaatgttgaagcaaca |
28958443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University