View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5668-94 (Length: 63)
Name: Solexa-NF5668-94
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5668-94 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 1846500 - 1846463
Alignment:
| Q |
26 |
ttatccctacctctggttacgagggagataacatcatt |
63 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1846500 |
ttatccctatctctggttacgagggagataacatcatt |
1846463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.00000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 7891221 - 7891258
Alignment:
| Q |
26 |
ttatccctacctctggttacgagggagataacatcatt |
63 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7891221 |
ttatccctatctctggttacgagggagataacatcatt |
7891258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 7891276 - 7891247
Alignment:
| Q |
1 |
aaggttagaagagcgctcaatgatgttatc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7891276 |
aaggttagaagagcgctcaatgatgttatc |
7891247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University