View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5668-96 (Length: 115)

Name: Solexa-NF5668-96
Description: NF5668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5668-96
Solexa-NF5668-96
[»] chr1 (1 HSPs)
chr1 (1-115)||(45513550-45513664)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 45513664 - 45513550
Alignment:
1 ccagctaagatcaaggtacacaagtctcttcaactcagcaaaccatgatggaattgaagttaaactatttttagaaaggctaaggtattcaattgaagtc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45513664 ccagctaagatcaaggtacacaagtctcttcaactcagcaaaccatgatggaattgaagttaaactatttttagaaaggctaaggtattcaattgaagtc 45513565  T
101 atgtttcgaaaaacc 115  Q
    |||||||||||||||    
45513564 atgtttcgaaaaacc 45513550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University