View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-1 (Length: 196)
Name: Solexa-NF5670-1
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 6e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 6e-79
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 41999235 - 41999054
Alignment:
| Q |
8 |
gaccaaatgacagttaaagatttcactggatactca----gtatctaaggggcaaaatcgtcacataactcaaattattcaacactatataataactacg |
103 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41999235 |
gaccaaatcacagttcaagatttcacaggatactcactcagtatctaaggggcaaaatcgtcacataactcaaattattcaacactatataataactacg |
41999136 |
T |
 |
| Q |
104 |
ttgtcagaacctcaaactcaaaccccatgcagaaactgtagtccaccgcaacaccataaactaagttcatcattaatttcat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41999135 |
ttgtcagaacctcaaactcaaaccccatgcagaaactgtagttcaccgcaacaccataaactaagttcatcattaatttcat |
41999054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University