View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-12 (Length: 157)
Name: Solexa-NF5670-12
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 7 - 157
Target Start/End: Complemental strand, 22330108 - 22329958
Alignment:
| Q |
7 |
caaaggagaaaacaaaccgtaatgaatctaggatacttcccttttaccaaggtcggaatcaactctcatacaatacacaacctgtttctttcgtcaacag |
106 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22330108 |
caaaggagcaaacaaaccataatgaatctaggatacttcccttttaccaaggtcggaatcaactctcatacaatacacaacctgtttctttcatcaacag |
22330009 |
T |
|
| Q |
107 |
tttctattgttcatggacaatgacttctcagtcaaatgctaccaaaaattc |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22330008 |
tttctattgttcatggacaatgacttctcagtcaaatgctaccaaaaattc |
22329958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University