View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-13 (Length: 151)
Name: Solexa-NF5670-13
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-13 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 12 - 151
Target Start/End: Complemental strand, 23818206 - 23818067
Alignment:
| Q |
12 |
atgaagaacctgtttgtaatgaagttcaaggaaagattaaaaagcaaggaggagaggtgaagaactatgttcatatgtagggaacttgtatgggcatagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
23818206 |
atgaagaacctgtttgtaatgaagttcaaggaaagattaaaaagcaaggaggagaggtgaagaactatgtttatatgtagggaacttgtatggacatagt |
23818107 |
T |
|
| Q |
112 |
gtggtggtccacacaagaaagatttatgaagcaccgatat |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
23818106 |
gtggtggtccacgtaagaaagatttatgaagcactgatat |
23818067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 23823476 - 23823438
Alignment:
| Q |
6 |
agtgagatgaagaacctgtttgtaatgaagttcaaggaa |
44 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
23823476 |
agtgacatgaagaacctgtttgtgatgaagttcaaggaa |
23823438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 12 - 44
Target Start/End: Complemental strand, 23827306 - 23827274
Alignment:
| Q |
12 |
atgaagaacctgtttgtaatgaagttcaaggaa |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
23827306 |
atgaagaacctgttagtaatgaagttcaaggaa |
23827274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University