View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-14 (Length: 147)
Name: Solexa-NF5670-14
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 7e-67
Query Start/End: Original strand, 14 - 147
Target Start/End: Original strand, 41998571 - 41998704
Alignment:
| Q |
14 |
gaaggaaaggaagggaggatatacagcgagggatttccccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998571 |
gaaggaaaggaagggaggatatacagcgagggatttcgccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc |
41998670 |
T |
 |
| Q |
114 |
tggtgagatgwaaccggtcatgtaaccggtacgg |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
41998671 |
tggtgagatgtaaccggtcatgtaaccggtacgg |
41998704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University