View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5670-14 (Length: 147)

Name: Solexa-NF5670-14
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5670-14
Solexa-NF5670-14
[»] chr2 (1 HSPs)
chr2 (14-147)||(41998571-41998704)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 7e-67
Query Start/End: Original strand, 14 - 147
Target Start/End: Original strand, 41998571 - 41998704
Alignment:
14 gaaggaaaggaagggaggatatacagcgagggatttccccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc 113  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41998571 gaaggaaaggaagggaggatatacagcgagggatttcgccggagatacctttccaatcggcgacggtgaagctcgagagacggttgaggtgacagattgc 41998670  T
114 tggtgagatgwaaccggtcatgtaaccggtacgg 147  Q
    |||||||||| |||||||||||||||||||||||    
41998671 tggtgagatgtaaccggtcatgtaaccggtacgg 41998704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University