View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-2 (Length: 162)
Name: Solexa-NF5670-2
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 136
Target Start/End: Original strand, 52887211 - 52887340
Alignment:
| Q |
7 |
agattgtaccatatatgacttttttctctccaacaatatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctattta |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
52887211 |
agattgtatcatatatgacttttttctctccaacaatatcactggacatgtggaacctttggccattgatgatggaagcactatcagattgggctattga |
52887310 |
T |
|
| Q |
107 |
tttctttccaagtatggctctcaaatacat |
136 |
Q |
| |
|
||||||| |||||||||||||||| ||||| |
|
|
| T |
52887311 |
tttcttttcaagtatggctctcaactacat |
52887340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 100; Significance: 9e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 9e-50
Query Start/End: Original strand, 7 - 110
Target Start/End: Complemental strand, 43716645 - 43716542
Alignment:
| Q |
7 |
agattgtaccatatatgacttttttctctccaacaatatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctattta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43716645 |
agattgtaccatatatgacttttttctctccaacaatatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctattga |
43716546 |
T |
|
| Q |
107 |
tttc |
110 |
Q |
| |
|
|||| |
|
|
| T |
43716545 |
tttc |
43716542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 7 - 123
Target Start/End: Original strand, 6814731 - 6814847
Alignment:
| Q |
7 |
agattgtaccatatatgacttttttctctccaacaatatcactggacatgtggaatctttggccattgatgatggaaacactatcagattgggctattta |
106 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||| ||||||| ||||| ||||||| |||||||||| ||||||||||| || | |||||||||| || | |
|
|
| T |
6814731 |
agattgtatcatatatgacatttttctcaccatcaatatctctggatatgtggagtctttggccagtgatgatggaagcattggcagattgggcaatcga |
6814830 |
T |
|
| Q |
107 |
tttctttccaagtatgg |
123 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
6814831 |
tttttttccaagtatgg |
6814847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University