View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5670-21 (Length: 56)
Name: Solexa-NF5670-21
Description: NF5670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5670-21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.00000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 9086878 - 9086911
Alignment:
| Q |
8 |
tggagctgttggtgttccatctacatttcatgcc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9086878 |
tggagctgttggtgttccatctacatttcatgcc |
9086911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University