View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5676-10 (Length: 88)
Name: Solexa-NF5676-10
Description: NF5676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5676-10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 29 - 88
Target Start/End: Original strand, 1316350 - 1316409
Alignment:
| Q |
29 |
ttgaacagtgaggatgcaggaaaacggatggcggttgcgaccggtcctacggcggttcga |
88 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1316350 |
ttgaacggtgaggatgcaggaaaacggatggcggttgcggccggtcctacggcggttcga |
1316409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University